Le dépistage des maladies sexuellement transmissibles chez des patients positifs au virus de l’immunodéficience humaine au Pérou révèle une absence de Chlamydia trachomatis et identifie Trichomonas vaginalis dans les échantillons pharyngés

Pour déterminer la prévalence des maladies sexuellement transmissibles, nous avons dépisté des patients infectés par le virus de l’immunodéficience humaine au Pérou, où le virus est majoritairement transmis sexuellement. Les patients présentaient de multiples facteurs de risque de MST et% de femmes et% d’hommes avaient au moins une gonorrhée. trichomoniase, herpès simplex, verrues anogénitales ou séropositivité à la syphilis Aucune infection à Chlamydia n’a été détectée, même si les taux d’infection dans la population générale sont de% -% Les patients recevant du triméthoprime-sulfaméthoxazoleTMP-SMZ sont moins susceptibles d’être atteints de cervicite. / ou oddrite de l’urétrite,; % intervalle de confiance, – Bien que le traitement ne soit pas optimal, l’administration de TMP-SMZ est efficace contre l’infection à chlamydia Nous supposons que l’utilisation de médicaments concomitants, comme le TMP-SMZ, peut prévenir par inadvertance l’infection à Chlamydia dans cette population. Trichomonas vaginalis dans les échantillons pharyngés d’hommes ayant des antécédents d’activité orogénitale Ceci n’a pas été rapporté précédemment et nécessite une étude plus approfondie

Chlamydia trachomatis est une cause majeure de maladies sexuellement transmissibles MST, et les patients infectés peuvent présenter une urétrite ou cervicite Les complications des infections non traitées comprennent la maladie inflammatoire pelvienne, la grossesse extra-utérine et l’infertilité chez les femmes, le syndrome de Reiter et l’épididymite chez les hommes. Les taux d’infection à Chlamydia varient de manière significative selon la population étudiée. Plusieurs études ont montré que chez les patients séropositifs, les taux d’infection à Chlamydia sont de% en%, soit environ le double de ceux observés chez les patients séropositifs. La population sexuellement active étant séronégative Comme l’infection asymptomatique est fréquente, des programmes de dépistage sont recommandés pour détecter les infections à Chlamydia chez les adolescents et les jeunes adultes sexuellement actifs. Les personnes infectées par le VIH devraient également subir un dépistage systématique des MST. Transmission du VIH par diminution de l’excrétion du VIH dans les sécrétions génitales De la variété des méthodes disponibles pour le diagnostic, la PCR a une sensibilité élevée% et spécificité% La prévalence du VIH au Pérou est%, et la transmission sexuelle est responsable de% des cas Certains groupes avec des taux élevés de VIH Les changements significatifs dans les modes de transmission comprennent l’augmentation de la transmission hétérosexuelle et l’augmentation subséquente du nombre de femmes infectées par le VIH Nous avons effectué une surveillance de la transmission de l’infection à Chlamydia. Etant donné que la transmission sexuelle est la voie d’infection par le VIH la plus courante au Pérou, nous nous attendions à ce que les patients séropositifs aient un taux d’infection à Chlamydia égal ou supérieur à supérieur à celui de la population générale Nous avons également testé d’autres MST, y compris la gonorrhée, la trichomonase et la syphilis

Patients et méthodes

étude de janvier à septembre Seuls les patients admis dans le service ou vus dans la clinique externe adjacente par l’un des médecins participant à l’étude ont été inclus. Les critères d’exclusion incluaient l’âge. Nous avons exclu les patients qui se présentaient uniquement pour être traités pendant une année, une grossesse, une inscription antérieure à l’étude et une plainte principale de symptômes liés aux MST. STDLes données démographiques et cliniques et l’histoire sexuelle ont été obtenues par interview directe avec un questionnaire semi-structuré. Un seul assistant de recherche a mené toutes les interviews. Un examen physique général a été effectué par un médecin et a inclus une inspection du pharynx, des organes génitaux externes et de l’anus. Les patientes positives aux MST ont reçu un traitement approprié, et des échantillons ont été obtenus de nouveau en quelques jours pour réévaluer l’infection à Chlamydia et les autres MST. Les patients ont également reçu des conseils et une éducation en matière de prévention. et tests de laboratoire Clinique spe Les écouvillons vaginaux et endocervicaux ont été prélevés chez les femmes, et des écouvillons urétraux ont été prélevés chez les hommes. Tous les écouvillons pour la PCR ont été recueillis dans des tampons tampons HCl M et de l’urine ont été prélevés. stocké à ° C et ont été transportés et testés dans la journée au laboratoire Universidad Peruana Cayetano HerediaPCR a été effectué sur tous les écouvillons et certains échantillons d’urine ADN a été extrait d’écouvillons avec l’utilisation de% Chelex-Bio-Rad comme décrit ailleurs Pour urine échantillons, des aliquotes de -mL ont été centrifugés à, à température ambiante. Le surnageant a été jeté et le culot a été remis en suspension dans des mL de tampon Tris HCl et centrifugé de nouveau à, g pendant min. Le surnageant a ensuite été jeté, et le culot a été remis en suspension dans – mL de tampon d’extraction d’ADN mmol de Tris HCl, mmol d’EDTA, et de% Chelex – Des solutions provenant à la fois d’écouvillons et d’échantillons d’urine ont été vortexées et le Après incubation, les préparations ont été chauffées à ° C pendant min et centrifugées pendant min. Une aliquote A -μL du surnageant a été utilisée pour l’amplification. Pour l’amplification, l’aliquote -μL du surnageant a été incubée à ° C pendant min. a été ajouté à des unités de Taq polymérase GIBCO, BRL; Life Technologies, tampon PCR mM de Tris HCl, mM de KCl et mM de MgCl, mM de désoxynucléotide triphosphates GIBCO, BRL et μmol de chacune des amorces ADN ciblant le ribosome CTR de l’ARN S [‘GGCGTATTTGGGCATCCGAGTAACG’] et le CTR [‘TCAAATCCAGCGGGTATTAACCGCCT ‘] Pour faire une solution -μL Les temps de cycle étaient s à ° C, suivis des cycles de ° C pour s, ° C pour s, et ° C pour s Dix μL de chaque produit PCR a été analysé par électrophorèse sur gel avec% L’électrophorèse a été réalisée avec un transilluminateur ultraviolet. Les résultats du test ont été considérés positifs lorsque le bp de C trachomatis a été observé. Les contrôles positifs et négatifs ont également été évalués. Des échantillons cliniques ont été testés par PCR pour Neisseria gonorrhoeae avec amplification des amorces. une cible -bp sur le gène cppB du plasmide cryptique PJD HO [‘GCTACGCATACCCGCGTTGC’] et HO [‘CGAAGACCTTCGAGCAGACA’] Pour évaluer la réactivité croisée, ces amorces PCR étaient également testées sur des souches de Neisseria meningitidis, Neisseria sicca, Neisseria lactamica, Moraxella catarrhalis, Staphylococcus species, Escherichia coli et des diplocoques gram négatif non-gonococciques d’espèces non identifiées Pour la détection de Trichomonas vaginalis, un examen en milieu humide a été effectué immédiatement après la collecte. PCR a été réalisée avec l’utilisation d’amorces pour amplifier l’unité S de l’ARN ribosome TV [‘TAATGGCAGAATCTTTGGAG’] et TV [‘GAACTTTAACCGAAGGACTTC’] Pour s’assurer que la PCR ne réagissait pas de manière croisée avec Trichomonas tenax, un protozoaire oral, Des souches de T tenax ont été testées contre les amorces de T vaginalis Des échantillons pharyngés positifs à T vaginalis par PCR ont également été testés avec des amorces pour T tenax afin d’évaluer la réactivité croiséeSyphilis La séroprévalence a été déterminée par le test rapide de réactigine plasmatique Omega Diagnostics Limited Sur des échantillons de sérum de patient, l’herpès simplex et les verrues anogénitales ont été diagnostiqués par examen clinique, Confirmation de laboratoire de hout Analyse statistique Les données ont été analysées avec le logiciel statistique SPSS SPSS Nous avons utilisé χ ou le test exact de Fisher pour les variables dichotomiques pour évaluer les associations, avec une erreur de type I considérée comme significative. Les facteurs comportementaux et cliniques ont été évalués en utilisant des rapports de cotes. Les cohortes de sexe masculin et de sexe féminin ont été analysées séparément parce que le sexe interagit avec d’autres facteurs de risque

Résultats

Démographie des patients et facteurs de risque de MST Cent sept patients,% hommes et% femmes, ont participé à la table d’étude. A partir des patients initiaux, ont été exclus pour l’âge et pour la grossesse Tous les patients éligibles ont accepté de participer L’âge moyen était les hommes et les années pour les femmes Les valeurs pour les hommes et les femmes étaient similaires en ce qui concerne le temps moyen depuis le diagnostic du VIH chez les hommes, mois; femmes, mois et nombre de cellules CD hommes: médiane, cellules / mm; moyenne, cellules / mm; femmes: médiane, cellules / mm; moyenne, cellules / mm à l’admission Aucun patient ne recevait de traitement antirétroviral

Tableau View largeTélécharger slideFacteurs de risque démographiques, comportementaux et cliniques pour les maladies sexuellement transmissibles MST chez les patients séropositifs à LimaTable View largeTélécharger slideFacteurs de risque démographiques, comportementaux et cliniques pour les maladies sexuellement transmissibles MST chez les patients séropositifs à LimaIl y avait des différences significatives entre les hommes et les femmes en ce qui concerne le type d’emploi, l’état civil, l’orientation sexuelle, les types d’activité sexuelle, le nombre de rencontres avec des travailleurs du sexe, le nombre de partenaires l’année précédente et le changement récent de partenaires. rapports sexuels, et% avaient aussi des antécédents de rapports sexuels anaux Vingt-quatre pour cent des femmes avaient & gt; Dans la cohorte masculine,% avaient des antécédents de rapports anaux réceptifs et% étaient bisexuels. Quatre-vingt-neuf pour cent avaient des rapports sexuels avec des travailleurs du sexe,% avaient plus que leur partenaire l’année précédente, et% utilisaient des préservatifs mais pas systématiquement La plupart des patients avaient des antécédents de symptômes de MST hommes,%; femmes,% et hommes traités,%; Dans l’analyse univariée, il n’y avait aucune association entre les facteurs de risque et le diagnostic de g MTS, gonorrhée, trichomonase, infection à Chlamydia, herpès simplex, verrues anogénitales, ou séropositivité de la syphilisClinical et résultats microbiologiques Aucun patient n’a été trouvé infecté par C trachomatis aux tables de tout site du corps et les contrôles négatifs et positifs pour la PCR étaient exacts Comparé aux taux d’infection chlamydiale dans la population générale, l’absence de une telle infection chez les patients séropositifs pour le VIH était très significative P & lt; Lors du suivi, les échantillons de femmes et d’hommes sont restés négatifs pour C trachomatis Bien qu’aucun des patients ne se soit plaint de symptômes liés aux MST,% des femmes et% des hommes présentaient des symptômes lorsqu’on leur posait des questions spécifiques. pertes vaginales chez les femmes% et écoulement urétral chez les hommes% Quarante-neuf pour cent des femmes présentaient des signes cliniques de cervicite, et% des hommes présentaient une urétrite

Tableau View largeTélécharger les résultats cliniques et cliniques pour les patients séropositifs à LimaTable View largeTélécharger les résultats cliniques et cliniques pour les patients séropositifs à Lima

Selon la PCR, la prévalence de Chlamydia trachomatis, Trichomonas vaginalis et Neisseria gonorrhoeae, selon les résultats de la PCRTable View largeDownload Prévalence de Chlamydia trachomatis, Trichomonas vaginalis et Neisseria gonorrhoeae selon les résultats de la PCR Trente-huit pour cent des femmes et% des hommes avaient MST, y compris la gonorrhée, la trichomonase, l’herpès simplex, les verrues anogénitales, ou la syphilis séropositivité De ces patients,% des femmes et% des hommes avaient ⩾ MST analyse PCR pour la gonorrhée était positive pour% des hommes et% des femmes lorsque des échantillons de tout le corps Cependant, lorsque nous avons examiné la spécificité des amorces sur d’autres isolats représentant la flore pharyngée, il y avait une réactivité croisée avec les souches de N meningitidis, N sicca, N lactamica, les espèces Staphylococcus et les diplocoques gram négatif non nongonococciques d’espèces non identifiées. échantillons pharyngiens et rectaux exclus Lorsque seuls les échantillons urogénitaux testés posi En ce qui concerne les gonocoques par analyse PCR, les gonocoques ont été trouvés chez% des hommes et% des femmes. Ils ont été isolés à partir de & gt; site chez la femme cervix / urine et homme urètre / urinePour les hommes et les femmes ont été infectés avec T vaginalis, comme indiqué par les résultats positifs de l’analyse PCR et frottis humides, y compris les échantillons pharyngés positifs des hommes Tous ces hommes avaient des antécédents de sexe orogénital activité seulement de la pharyngite avait, et l’autre étaient asymptomatiques En outre, seulement des T vaginalis avaient identifié dans les spécimens des sites urogénitaux ainsi que du pharynx du pharynx, de l’urètre et de l’urine PCR pour T tenax un trichomonad communément trouvé dans la plaque dentaire était négatif pour ces spécimens pharyngésSyphilis sérologie était positive pour% des hommes et% des femmes Il y avait une différence significative entre les hommes et les femmes en ce qui concerne la syphilis séropositivité P =, mais pas en ce qui concerne les autres MST ,% d’hommes et% de femmes avaient reçu un antimicrobien à activité antichlamydique, comme le triméthoprime-sulfaméthoxazole TMP-SMZ, la rifampine, Tableau sur la xicilline ou la clarithromycine Vingt-quatre pour cent de ces patients recevaient des antibiotiques ayant une activité antichlamydienne. Les patients recevaient du TMP-SMZ soit en prophylaxie contre la pneumonie à Pneumocystis carinii, soit en%; femmes,% ou comme traitement pour la diarrhée ou les infections des voies respiratoires hommes,%; femmes,% Les patients recevant du TMP-SMZ étaient significativement moins susceptibles d’avoir une cervicite et / ou une urétrite P =; OU, ; % IC, – Si un patient a reçu un traitement ou des doses prophylactiques de TMP-SMZ ne fait aucune différence dans la probabilité de cervicite et / ou d’urétrite Lorsque les antibiotiques ont été regroupés, les patients recevant ⩾ de l’un des antibiotiques avec antihlamydia susceptibles d’avoir une cervicite et / ou une urétrite P =; OU, ; % CI, –

Tableau View largeTélécharger slideUtilisation antibiotique dans les jours précédant l’inscription à l’étude et son association avec l’urétrite et / ou la cervicite chez les patients séropositifs au LimaTable View largeTélécharger slideUtilisation antibiotique dans les jours précédant l’inscription à l’étude et son association avec urétrite et / ou cervicite chez les patients séropositifs au VIH. LimaQuand la cohorte masculine a été analysée séparément, une association a été trouvée entre les hommes ayant une prévalence inférieure d’urétrite et l’utilisation de TMP-SMZ seule P =; OU, ; % IC, – ou utilisation d’un antibiotique with avec une activité antichlamydiale P =; OU, ; % IC, – Cependant, chez les femmes, il n’y avait pas d’association significative entre l’utilisation d’antibiotiques et la cervicite. Parmi les patients recevant de la ciprofloxacine, seule la gonorrhée était présente, mais cette association n’était pas significative. % CI, – Lorsque les MST ont été regroupées, il n’y avait aucune association entre les hommes et les femmes entre l’utilisation d’antibiotiques et recevoir un diagnostic de ⩾ des suivants: la gonorrhée, la trichomonase, la syphilis, l’herpès ou les verrues anogénitales

Discussion

Effet protecteur ilarien contre la gonorrhée urogénitale La protection peut ne pas se produire car N gonorrhoeae, contrairement à C trachomatis, devient rapidement résistante aux antibiotiques en développant une résistance à médiation chromosomique et à médiation plasmidique Au Pérou, taux d’isolement du N résistant à la pénicilline et aux tétracyclines les gonorrhées sont de haute résistance à la pénicilline,%; tétracycline,%, mais une résistance élevée n’a pas été démontrée pour la ciprofloxacine, l’érythromycine ou la ceftriaxone L’analyse PCR de C trachomatis a été testée sur d’autres populations et a donné des taux attendus d’infection à Chlamydia en utilisant les mêmes techniques, laboratoire et Ces échantillons ont également été inclus dans les mêmes analyses PCR que les échantillons provenant des patients séropositifs. Le manque de résultats positifs pour nos patients n’était donc pas dû à une erreur de laboratoire. Les données démographiques des patients peuvent également influencer les taux d’infection à Chlamydia. facteurs de risque d’infection, tels que antécédents de MST, survenue d’autres MST au moment de l’étude , partenaires sexuels multiples et utilisation irrégulière du préservatif Bien que l’analyse univariée n’ait pas démontré d’association significative entre facteurs de risque potentiels et STD, les tailles d’échantillon étaient petites, et l’analyse manquait donc de puissanceIl est intéressant de comparer les facteurs de risque dans notre population Les chercheurs ont examiné les pratiques sexuelles et les MST chez des adultes sains, séronégatifs et sexuellement actifs des quartiers socio-économiques défavorisés de Lima Dans notre population et dans la population en bonne santé, ~% des hommes ont eu & gt ; partenaire dans l’année précédente Les femmes, cependant, étaient très différentes Dans notre étude,% de femmes avaient & gt; partenaire dans l’année précédente, comparé au% de femmes dans la population saine Cervicite a été diagnostiqué dans% de femmes dans notre étude, comparé au% dans la population saine En ce qui concerne les facteurs de risque d’infection HIV, dans notre étude% de Les femmes pratiquaient des relations anales réceptives, vs% de femmes dans la population en bonne santé. Ces résultats indiquent que nos patients peuvent avoir un grand nombre de facteurs de risque de MST. Cependant, nos patients peuvent avoir modifié leurs pratiques sexuelles pour les rendre plus sûres. Réduire la transmission du VIH Par exemple, dans notre étude,% d’hommes et% de femmes ont déclaré utiliser le préservatif. Dans la population en bonne santé, seulement% des hommes et% des femmes avaient utilisé des préservatifs l’année précédente. utilisation inconsidérée du préservatif Une nouvelle découverte dans notre étude a été la détection de T vaginalis dans les échantillons pharyngés de patients masculins. T vaginalis a été précédemment isolé à partir de spécimens nasopharyngés de nourrissons atteints de troubles respiratoires. facilité d’accès aux mères ayant des antécédents d’infection génitale T vaginalis Cependant, l’identification de T vaginalis dans le pharynx d’un adulte n’a pas été décrite précédemment Aucune réaction croisée entre les amorces de T vaginalis et les souches de T tenax n’était évidente , et les spécimens pharyngés de ces patients n’ont pas donné une réaction positive à T tenax. Il est hors de propos de spéculer sur l’occurrence ou la pathogenèse de T vaginalis dans les échantillons pharyngiens, et des investigations complémentaires sont nécessaires. Les amorces de PCR utilisées pour diagnostiquer la gonorrhée Nous avons noté une réactivité croisée avec N meningitidis et d’autres isolats typiques de la flore pharyngienne normale anxiété. Nous déconseillons donc l’utilisation de ces amorces pour les échantillons pharyngiens. , la valeur de l’utilisation de ces amorces sur des spécimens d’autres sites extra-génitaux, tels que le rectum, devrait être étudiée. Si nous avons exclu les prélèvements rectaux et pharyngés dans notre étude, la prévalence de la gonorrhée est sous-estimée La prévalence des rapports anaux réceptifs est élevée, en particulier chez les femmes, et nous nous attendons donc à une présence de gonorrhée anorectale. cliniciens expérimentés, souvent non fiables Parce que le test de dépistage de la syphilis spécifique au Treponema n’a pas été effectué et que l’herpès simplex a été diagnostiqué cliniquement, sans confirmation en laboratoire, un surdiagnostic de syphilis et un sous-diagnostic d’autres ulcères génitaux, comme l’herpès simplex. , le taux de MST chez les patients séropositifs au Pérou est élevé, et ces patients doivent être dépistés lorsqu’ils se présentent aux médecins pour une raison quelconque Les patients doivent être spécifiquement interrogés sur les symptômes des MST, car la plupart de nos patients ont des symptômes évocateurs d’une MST mais n’a pas présenté à cause d’eux Parce que les patients séropositifs pourraient b e protection contre l’infection à chlamydia par antibiothérapie prophylactique ou intermittente de courte durée, si les prélèvements sont négatifs lors de la visite initiale, ces patients doivent être suivis et revérifiés lorsque le traitement antibiotique est arrêté ou si des symptômes apparaissent

Membres participants du Groupe de travail sur le sida au Pérou

Kalina Campos Gala, Guido De la Cruz, Patricia Garcia et Holger Mayta Universidad Peruana Cayetano Heredia, Lima, Pérou; et Gonzalo Chavez, Yuri Garcia, Marcos Ñavincopa, Sixto Sanchez et Eduardo Tarazona Hôpital Dos de Mayo, Lima, Pérou

Remerciements

Nous remercions les patients et le personnel de l’hôpital Dos de Mayo pour leur participation et leur coopération et W Bowie et D Patrick pour avoir révisé le manuscrit. Le soutien technique de J B Phu et D Sara est également apprécié

You may also like...